Annale corrigée Pratique du raisonnement scientifique 1

Croissance des plantes : hormones végétales et influence de l'environnement

Exercice 2

Croissance des plantes : hormones végétales et influence de l'environnement

1 h 50

9 points

Intérêt du sujet • Avec ce sujet, vous allez expliquer comment les facteurs de l'environnement agissent sur la croissance des plantes à travers l'expression de gènes qui dirigent la production d'hormones végétales.

 

En utilisant les informations extraites des documents et vos connaissances, expliquez comment le génome d'une plante intervient sur sa croissance et comment l'expression de ce génome peut être influencée par des facteurs environnementaux.

DOCUMENT 1Croisements entre deux lignées pures de pois

a) Deux variétés de lignée pure de pois

svtT_2000_00_33C_01

b) Un croisement entre les deux lignées pures A et B

Au cours d'expériences d'hybridation dans les années 1860, qui allaient aboutir à une première formulation des lois de l'hérédité, le moine et botaniste autrichien Gregor Johann Mendel (1822-1884) a croisé des pois appartenant aux deux lignées pures A et B.

En F1, il a obtenu uniquement des pois de taille normale.

Il a ensuite croisé des individus F1 avec des pois nains : la génération obtenue était constituée de 50 % de pois normaux et 50 % de pois nains.

Document 2Les allèles du gène impliqué

Beaucoup plus tard, au début des années 1980, on a établi que le gène en jeu dans les expériences de G. Mendel code pour une enzyme qui intervient au cours de la dernière étape de la synthèse d'une hormone végétale, la gibbérelline. Chez les pois de taille normale, la séquence de cette enzyme comprend 374 acides aminés.

a) Extrait de séquence nucléotidique du gène codant pour la gibbérelline chez le pois de taille normale

La séquence suivante est relative à l'allèle du gène codant pour l'enzyme chez les pois de lignée pure. Il s'agit de la séquence non transcrite du gène.

363GGATATGGCATCGCTCGTATCTCTTCCAUGAAA396

b) Extrait de la séquence nucléotidique du gène codant pour la gibbérelline chez le pois nain

La séquence correspondante de l'allèle du gène présent chez les pois nains est :

363GGATATGGCATCCTCGTATCTCTTCCATGAAA396

Le nucléotide 363 est le premier nucléotide d'un codon et le nucléotide 396 est le dernier nucléotide d'un codon. Ces séquences sont des séquences partielles des allèles, et c'est la seule région de la séquence entière où il y a des différences entre les deux allèles.

Le code génétique, exprimé en « langage » ARNm indique que les codons UAG, UGA et UAA sont des codons-stop.

Document 3Action de la gibbérelline

La quantité de gibbérelline est de 0,01 ng/plante pour les pois nains, et de 1 ng/plante pour les pois de taille normale.

Lorsque des pois nains (A) sont pulvérisés d'une solution de gibbérelline, ils acquièrent la morphologie indiquée en B. Le schéma C représente un pois de taille normale à l'état adulte.

svtT_2000_00_33C_02

Document 4Photopériode et croissance de la tige florifère des épinards

a) Importance de la durée d'éclairement sur la croissance

Les épinards sont des plantes qui changent d'aspect en fonction d'un facteur d'environnement : la durée d'éclairement (photopériode).

Cultivés en jours courts (durée d'éclairement inférieure à 13 heures), les plants d'épinard ont un aspect en rosette, lié au fait que les entre-nœuds de la tige au centre de la rosette ne se développent pas.

Placés en jours longs, les plants d'épinard présentent un al­lon­gement de leur tige à partir du 10e jour d'exposition.

b) Photopériode et production de gibbérelline

Le tableau ci-dessous indique la quantité de gibbérelline trouvée dans des pieds d'épinards, après un passage plus ou moins long en jours longs.

Tableau de 2 lignes, 5 colonnes ;Tetière de 1 lignes ;Ligne 1 : Nombre de jours d'exposition à une photopériode « jours longs »;0;4;8;12;Corps du tableau de 1 lignes ;Ligne 1 : GA1* (en ng/g de plante); 1,0; 3,5; 3,7; 5,1;

*GA1 = gibbérelline active

Document 5La gibbérelline et la croissance de la tige des épinards

Soumis à un apport (par pulvérisation) de gibbérelline GA1, des épinards en rosette et maintenus en éclairement en « jours courts » présentent un allongement de leur tige comme si on les cultivait en « jours longs ».

Une pulvérisation de gibbérelline GA20, substance à partir de laquelle se forme la gibbérelline GA1, ne provoque pas l'élongation de la tige.

Chez le pois, comme chez l'épinard, la synthèse de GA1 se fait à partir de GA20.

 

Les clés du sujet

Étape 1. Comprendre le sujet

Le sujet porte sur deux aspects complémentaires de la physiologie de la croissance des plantes.

Dans un premier temps, à partir de données chez le pois, il s'agit de montrer que la croissance a un déterminisme génétique qui s'exprime à travers la synthèse d'une hormone végétale.

Dans un second temps, à partir de données sur la croissance des épinards, il s'agit de montrer comment un facteur d'environnement agit sur le phénotype d'une plante à partir de son action sur l'expression d'un gène impliqué dans la synthèse d'une hormone végétale.

Étape 2. Exploiter les documents

L'exploitation des documents 1 à 3, relatifs au pois, fait appel à des modes de raisonnement liés aux principes de base de la génétique, ainsi qu'à des connaissances de 1re sur les modalités de l'expression des gènes.

Le document 4, sur les épinards, doit vous conduire à démontrer que la durée d'éclairement (photopériode) a des répercussions sur le phénotype de la plante par l'intermédiaire d'une hormone végétale.

Le document 5 conduit à dégager l'idée que l'expression d'un gène impliqué dans la chaîne de biosynthèse de la gibbérelline dépend des caractéristiques de la photopériode à laquelle est soumise la plante.

Étape 3. Construire la réponse

Tableau de 3 lignes, 2 colonnes ;Corps du tableau de 3 lignes ;Ligne 1 : I. Déterminisme génétique de la croissance de la tige du pois; Déduisez des résultats des croisements des pois le nombre de gènes impliqués dans la différence de taille des pois.Comparez à partir des données fournies l'activité de l'enzyme codée par les allèles du gène chez les pois de taille normale et les pois nains.Reliez les génotypes des pois nains et des pois de taille normale à leurs phénotypes moléculaires et macroscopiques.; Ligne 2 : II. Influence de l'environnement sur la croissance; Établissez une relation entre la durée de l'éclairement et la richesse en gibbérelline des épinards.Expliquez comment la durée d'éclairement affecte le phénotype macroscopique des épinards en agissant sur l'expression d'un gène.; Ligne 3 : Conclusion; Précisez le déterminisme génétique commun de la croissance des pois et des épinards.Indiquez comment l'environnement agit sur ce déterminisme génétique chez l'épinard.Schématisez la succession des processus chez les épinards lorsqu'on passe des jours courts aux jours longs.;

Introduction

Les végétaux se caractérisent par leur plasticité vis-à-vis des facteurs de l'environnement. Parmi ces facteurs, la durée d'éclairement agit sur la croissance de certaines plantes. Après avoir montré comment le génome contrôle la croissance végétale, nous envisagerons comment un facteur environnemental intervient dans la croissance en agissant lui-même sur le génome.

I. Déterminisme génétique de la croissance de la tige du pois

A. La différence phénotypique est due à un seul gène

Les différences de taille (document 1a) entre les deux lignées pures de pois sont héréditaires. Le document 1b, montre que le phénotype [pois nain] est récessif et que le phénotype [taille normale] est dominant.

En conséquence, le deuxième croisement est un croisement-test (F1 × Individu­ récessif) et les résultats indiquent que les deux variétés ne diffèrent que par un seul gène.

Le conseil de méthode

C'est en observant la descendance du test-cross et en voyant qu'elle est constituée de deux phénotypes en quantité égale que l'on peut déduire que la différence phénotypique est due à un seul gène.

B. Comparaison des séquences des deux allèles

Pour comparer les séquences partielles des deux allèles, il est bon de les écrire sous forme d'une succession de codons :

Allèle n+ (pois de taille normale)

GGA TAT GGC ATC GCT CGT ATC TCT TCC AUG AAA

Allèle n (pois nain)

GGA TAT GGC ATC CTC GTA TCT CTT CCA TGA AAA

Puisqu'un codon correspond à un triplet de nucléotides, le premier codon à gauche de la séquence partielle est le 121e (363/3 = 121).

On s'aperçoit que les deux allèles diffèrent à partir du 125e codon. Cela est dû au fait que le nucléotide à guanine (G) présent en position 375 sur l'allèle n+ n'existe pas sur l'allèle n. Ce dernier est un allèle muté qui dérive de l'allèle n+par délétion d'un nucléotide à guanine en position 375.

La séquence de l'ARN messager (ARNm) est la même que celle du brin non transcrit de l'ADN (en remplaçant T, thymine, par U, uracile). On constate que cette délétion entraîne la formation du codon UGA à la position 130 de cet ARNm. Or ce codon est un codon-stop. Cela signifie qu'au cours de la traduction de l'ARNm, la synthèse de la protéine enzymatique s'arrêtera en position 129.

La protéine codée par l'allèle n ne comportera ainsi que 129 acides aminés, contre 374 pour celle codée par l'allèle n+. Cette réduction considérable de sa séquence fait qu'elle est très probablement inactive.

Cela est confirmé par les dosages de la gibbérelline qui indiquent une quantité 100 fois inférieure chez les pois nains par rapport à ceux de taille normale.

En outre, puisque les pois nains atteignent une taille normale après trai­tement à la gibbérelline (document 3), cela signifie que la seule mutation du gène codant pour l'enzyme intervenant dans la dernière étape de la synthèse de la gibbérelline suffit pour engendrer le phénotype [pois nain].

La croissance de la tige du pois a donc un déterminisme génétique qui se traduit phénotypiquement par la synthèse d'une hormone.

II. Influence de l'environnement sur la croissance

A. Photopériode et élongation de la tige

La croissance de la tige d'épinard dépend de la durée d'éclairement journalière à laquelle est soumise la plante : quasi nulle avec une photopériode de jours courts, elle démarre avec une exposition prolongée à des photopériodes de jours longs.

La question est de déterminer comment la photopériode « jours longs » finit par provoquer l'élongation de la tige.

B. Photopériode et synthèse de gibbérelline

La quantité de gibbérelline présente dans les tiges des épinards augmente à la suite de l'exposition à des jours longs, et ce d'autant plus que le nombre de jours d'exposition à cette photopériode est grand.

La photopériode « jours longs » a donc deux effets : provoquer l'élongation de la tige d'une part, et déclencher la synthèse de gibbérelline d'autre part.

Connaissant le rôle de cette hormone sur la croissance de la tige du pois, on peut supposer que l'effet premier est la synthèse de l'hormone qui entraîne par la suite l'élongation de la tige.

Cette hypothèse est confirmée par le fait que l'application de gibbérelline GA1 à des épinards en rosette maintenus en jours courts entraîne l'élongation de la tige.

C. Mécanisme d'action de la photopériode sur la synthèse de gibbérelline

L'exposition aux jours longs a donc pour effet de déclencher la mise en route de la chaîne de biosynthèse de la gibbérelline, et notamment la dernière étape qui chez l'épinard comme chez le pois assure la conversion de gibbérelline GA20 en gibbérelline GA1, hormone active sur l'élongation de la tige.

Contrairement à la GA1, la GA20, précurseur immédiat de la GA1, n'a aucun effet sur la croissance de la tige des épinards maintenus en jours courts.

La photopériode a donc pour effet de permettre la réaction de conversion de la GA20 en GA1 ; cela implique la synthèse de l'enzyme qui catalyse la réaction, donc l'expression du gène qui code pour cette enzyme.

Chez l'épinard le gène ne s'exprime pas en jours courts, il ne s'exprime qu'en jours longs.

à noter

Il est possible que d'autres gènes codant pour des enzymes impliquées dans la chaîne de biosynthèse soient aussi activés par la photopériode « jours longs ».

Conclusion

Chez le pois comme chez l'épinard, l'élongation de la tige dépend de la synthèse d'une hormone, la gibbérelline.

Cette hormone résulte de l'expression de gènes intervenant dans sa synthèse, comme celle du gène qui code pour une enzyme catalysant la conversion de la GA20 en GA1. Une mutation de ce gène entraîne la synthèse d'une enzyme inactive et a pour effet de bloquer la croissance de la tige chez les deux plantes.

Chez l'épinard, l'expression du gène est en outre affectée par un facteur de l'environnement : la photopériode.

Pour que la tige grandisse, il faut que le gène code pour une enzyme fonctionnelle mais, de plus, que la plante soit exposée à la photopériode « jours longs ».

Nous pouvons résumer dans un schéma les relations entre l'environnement et le phénotype des épinards à différentes échelles (figure 1).

svtT_2000_00_33C_03

Figure 1. Influence de l'environnement sur la croissance de l'épinard

Accéder à tous les contenus
dès 6,79€/mois

  • Les dernières annales corrigées et expliquées
  • Des fiches de cours et cours vidéo/audio
  • Des conseils et méthodes pour réussir ses examens
  • Pas de publicités
S'abonner