La détection d'ogm

Merci !

Exercices
Classe(s) : 1re S | Thème(s) : Le patrimoine génétique


n Pour connaître le pourcentage de soja génétiquement modifié dans un dessert à base de soja, ne contenant que d’infimes traces d’ADN, on utilise la technique de la PCR – Polymerase Chain Reaction (ou ACR en français : amplification en chaîne par polymérase). Cette technique permet de réaliser des millions de copies d’un fragment d’ADN en quelques heures et rend ainsi possible la détection et la quantification des gènes.

n L’analyse repose sur une double amplification. L’amplification d’un gène spécifique de l’espèce soja (gène codant la lectine, une protéine du soja) permet d’évaluer la quantité d’ADN de soja présent dans l’échantillon. L’amplification d’une partie du transgène permet d’évaluer la quantité d’ADN correspondant à la présence d’OGM. La réglementation impose l’obligation d’étiquetage si le pourcentage d’ADN transgénique dépasse 1 % de la teneur totale en ADN de soja du produit.

Doc. 13 Technique de la PCR

La technique de PCR permet de multiplier par réplication le segment d’ADN qui contient le gène recherché : l’ADN « cible ». Elle débute par l’ouverture des molécules d’ADN puis l’appariement de deux amorces (brins simples d’ADN constitués de quelques nucléotides) complémentaires des extrémités de la séquence à amplifier. Ces amorces déterminent le point de départ de la réplication de l’ADN.

Doc. 14 Protocole expérimental

Une PCR classique se déroule dans un tube que l’on place dans un thermocycleur, un appareil qui permet d’adapter la température à laquelle se trouve le tube.

Avant la réaction, tous les acteurs de la PCR sont introduits dans le tube :

– l’ADN présent dans l’échantillon ;

– les amorces du ou des gènes cibles ;

– l’ADN polymérase active à des températures élevées, appelée TAQ polymérase ;

– des nucléotides libres.

Puis les cycles de réplication s’enchaînent. Un cycle dure 3 minutes et est constitué de trois phases :

1. Dénaturation de l’ADN quelques secondes à 94 °C : cette température élevée détruit les liaisons faibles qui existent entre les paires complémentaires de nucléotides et provoque la séparation des deux brins de l’ADN.

2. Appariement des amorces à 60 °C.

3. Polymérisation des nucléotides sous l’action de l’ADN polymérase à partir des amorces à 72 °C.


Doc 15.  Séquence des amorces

l Amorce 1 du gène de la lectine de soja :

TCCACCCCCATCCACATTT

l Amorce 2 du gène de la lectine de soja :

GGCATAGAAGGTGAAGTTGAAGGA

l Amorce 1 du transgène :

GCCATGTTGTTAATTTGTGCCAT

l Amorce 2 du transgène :

GAAGTTCATTTCATTTGGAGAGGAC

1. Schématisez l’ensemble des molécules présentes dans le tube de PCR.

2. Pourquoi doit-on refroidir le milieu entre les deux premières étapes d’un cycle de PCR ?

Lors de la réplication, les nucléotides libres doivent se positionner en face des nucléotides du brin matrice avant d’être reliés entre eux.

3. Écrivez les séquences des extrémités du gène de la lectine de soja.

Un gène est un fragment d’ADN, donc est constitué de deux brins complémentaires.

4. Combien obtient-on de copies d’un même segment d’ADN après 30 opérations de PCR ?

5. Une technique appropriée permet de révéler les fragments d’ADN répliqués dans le tube et d’en déduire le pourcentage d’ADN de soja total : 30 % ainsi que le pourcentage d’ADN de soja génétiquement modifié : 0,5 % de l’échantillon testé. Le dessert doit-il être étiqueté comme contenant des OGM ?